logo

Basic information
Operon ID 1382492
Size 1
Protein gene number 1
RNA gene number 0
Similar operon number 0
Species nameEscherichia coli str. K-12 substr. MG1655
NC name NC_000913
NC descriptionEscherichia coli str. K-12 substr. MG1655 chromosome, complete genome.
Reference No available reference
Genes
GIStartEndStrand GeneSynonymCOGProduct
145698252 1342460 1342633 - yciZ b4596 - hypothetical protein
Terminator
All motifs in 1382492 promoter, the 1382492_4 motif in this regulon
All Motif logo Length Pvalue Number   








1382492-4






20






0.0037 (243)






5
Seq Start End Motif Score Info
1 85 104 TTCTCTTTTAGCGGCAATTT 24.32 NC_000913_opr_1382492_gi_145698252_-_1
2 85 104 TTCTCTTTTAGCGGCAATTT 24.32 NC_013941_opr_2800230_gi_291282374_-_0.697553743513714
4 85 104 TTCTCTTTTAGCGGCAATTT 24.32 NC_010658_opr_2309368_gi_187732636_-_0.605817068503636
3 94 113 TTCTCTTTTCAGAGTAATTT 18.72 NC_015761_opr_3232426_gi_339999539_+_0.626192893401015
5 41 60 TCCTCTCCATCCTGCTATTT 16.16 NC_013850_opr_2779003_gi_288935891_+_0.530771789753826